Select one or more datasets. Note: selecting too many datasets may lead to a timeout.
Select a k-mer, such as "TGGACATCGGTCTGACCAACGAGAAGCCCAATCCGGAACT", to search for. Note: selecting a small k-mer can match many reads leading to longer computations.
Citations:
Crowley JJ et al. (2015). Analyses of allele-specific gene expression in highly divergent mouse crosses identifies pervasive allelic imbalance. Nature genetics.
Keene TM et al. (2011) Mouse genomic variation and its effect on phenotypes and gene regulation. Nature 477: 289-294. http://dx.doi.org/10.1038/nature10413; http://www.sanger.ac.uk/resources/mouse/genomes/
Phifer-Rixey M, Bomhoff M, Nachman MW. (2014) Genome-wide patterns of differentiation among house mouse subspecies. Genetics 198(1): 283-297. http://dx.doi.org/10.1534/genetics.114.166827
The Wellcome Trust Sanger Center. Caroli Genome Project. http://www.ncbi.nlm.nih.gov/bioproject/PRJEB2188